SyncSchema - Synchronize a schema with its remote version in Chewie-NS
The SyncSchema module allows users to synchronize local schemas, previously downloaded from a Chewie-NS instance, with their remote versions. All chewBBACA users can synchronize schemas to get the latest alleles added to Chewie-NS and to ensure that a common allele identifier nomenclature is maintained for the alleles that are common between the local and remote schemas. We also provide the option to submit novel alleles, that were identified locally and are not present in Chewie-NS.
Important
Only authorized users can submit new local alleles to update remote schemas, although all users can download schemas and novel alleles from the Chewie-NS public server. Please send a request to imm-bioinfo@medicina.ulisboa.pt if you wish to submit novel alleles.
To synchronize a local schema with its remote version in Chewie-NS it is only necessary to provide the path to the schema directory. The simplicity of the process is ensured by a configuration file, present in all schemas downloaded from Chewie-NS, that contains the identifier of the schema in Chewie-NS and the last modification date of the schema.
Configuration file content
['2020-06-30T19:10:37.466104', 'http://chewbbaca.online/NS/api/species/9/schemas/1']
Novel alleles identified locally are added to the schema with a * preceding their integer identifier to indicate these are temporary designations. In the example below alleles 4 to 7 were detected locally but were not present in the database that had been retrieved from the Chewie-NS public server.
Local FASTA file example
>prefix-018550_1
ATGAGCAAGCCTAATGTTGTTCAGTTAAATAATCAATATATTAACGATGAGAATCTAAAAAAACGTTACGAAGCTGAGGAGTTACGCTAA
>prefix-018550_2
ATGAGCAAGCCTAATGTTGTTCAGTTAAATAATCAATATATTAACGATGAGAATCTAAAAAAACGTTACGAAGCTGAGGAGTTACGCTAA
>prefix-018550_3
ATGAGCAAGCCTAATGTTGTTCAGTTAAATAATCAATATATTAACGATGAGAATCTAAAAAAACGTTACGAAGCTGAGGAGTTACGCTAA
>prefix-018550_*4
ATGAGCAAGCCTAATGTTGTTCAGTTAAATAATCAATATATTAACGATGAGAATCTAAAAAAACGTTACGAAGCTGAGGAGTTACGCTAA
>prefix-018550_*5
ATGAGCAAGCCTAATGTTGTTCAGTTAAATAATCAATATATTAACGATGAGAATCTAAAAAAACGTTACGAAGCTGAGGAGTTACGCTAA
>prefix-018550_*6
ATGAGCAAGCCTAATGTTGTTCAGTTAAATAATCAATATATTAACGATGAGAATCTAAAAAAACGTTACGAAGCTGAGGAGTTACGCTAA
>prefix-018550_*7
ATGAGCAAGCCTAATGTTGTTCAGTTAAATAATCAATATATTAACGATGAGAATCTAAAAAAACGTTACGAAGCTGAGGAGTTACGCTAA
On synchronizing, novel alleles retrieved from Chewie-NS are compared to novel local alleles and the process reassigns allele identifiers to ensure that the alleles common to local and remote schemas have the same identifiers. Local alleles that are not in Chewie-NS are shifted to the last positions in the FASTA files and keep a * in the identifier. If a user wants to submit those alleles (only available to authorized users), it is necessary to use the --submit flag and the necessary data will be collected and uploaded to Chewie-NS. Chewie-NS will return the identifiers assigned to the submitted alleles and the local process will remove the * from the submitted alleles and assign the permanent identifiers. If the process retrieves new alleles from Chewie-NS, it will redetermine representative sequences ONLY for the loci in the local schema that were altered by the synchronization process.
Important
It is strongly advised that users adjust the value of the --cpu argument in order to accelerate the determination of representative sequences.
Basic Usage
To synchronize a local schema we only need to provide the path to the directory that contains the schema:
chewBBACA.py SyncSchema -i path/to/SchemaFolder
The --submit argument allows users to submit novel alleles in their local schema to Chewie-NS:
chewBBACA.py SyncSchema -i path/to/SchemaFolder --submit
Parameters
-sc, --schema-directory (Required) Path to the directory with the schema to be synced (default: None).
--cpu, --cpu-cores (Optional) Number of CPU cores/threads that will be used to run the process
(chewie resets to a lower value if it is equal to or exceeds the total
number of available CPU cores/threads). This value is only used if the
process retrieves novel alleles from the remote schema and needs to
redetermine the set of representative alleles for the local schema (default: 1).
--ns, --nomenclature-server (Optional) The base URL for the Chewie-NS instance. The default
option will get the base URL from the schema's URI. It is also
possible to specify other options that are available in chewBBACA's
configs, such as: "main" will establish a connection to "https://chewbbaca.online/",
"tutorial" to "https://tutorial.chewbbaca.online/" and "local" to
"http://127.0.0.1:5000/NS/api/" (localhost). Users may also provide
the IP address to other Chewie-NS instances (default: None).
--b, --blast-path Path to the directory that contains the BLAST executables (default:None).
--submit If the process should identify new alleles in the local schema and
send them to the Chewie-NS instance. (only authorized users can submit new alleles)
(default: False).
Workflow of the SyncSchema module
The SyncSchema module retrieves new alleles added to remote schemas in Chewie-NS and submits new alleles added to local schemas to update the remote schemas in Chewie-NS. Brief description of the workflow:
The process starts by reading the schema’s configuration file to get the schema’s parameter values and ensure the values match the ones listed in Chewie-NS.
If the user wants to submit new alleles identified locally (
--submit), the process will ask for the user credentials to verify if the user has contributor privileges.Before retrieving or uploading new alleles, the process verifies if the last modification date of the local and remote schemas match. If the dates match and the user does not want to submit new local alleles, the process exits.
If the dates do not match or the user wants to submit new local alleles, the process retrieves new alleles added to the remote schema since the last modification date and compares them with the alleles in the local schema.
If any alleles are exclusive to the local or remote schema, the process creates updated FASTA files with all the alleles and locks the remote schema to ensure that only the current user can modify the remote schema.
The process creates files with the data for the new local alleles and sends them to Chewie-NS, waiting for Chewie-NS to insert the new alleles into the database.
After allele insertion in Chewie-NS, the process adapts the updated FASTA files with the PrepExternalSchema module to update the local schema and ensure that the local and remote allele identifiers match.
If the schema was already locked by another user, the process will skip data upload to Chewie-NS and will update the local schema with new alleles retrieved from Chewie-NS.